View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16572_high_29 (Length: 245)
Name: NF16572_high_29
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16572_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 234
Target Start/End: Original strand, 34432774 - 34432988
Alignment:
| Q |
21 |
acaggcttatatatggaaggctggtgggtgagtggtattgaagaaca-atgaagttctcaaatacaacttaattattggtaatggaaaatggcgacttca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432774 |
acaggcttatatatggaaggctggtgggtgagtggtattgaagaacacatgaagttctcaaatgcaacttaattattggtaatggaaaatggcgacttca |
34432873 |
T |
|
| Q |
120 |
atatttcacttataccgtnnnnnnncttgatttagtattgattttataagtggaagtttatataggtatttagacttgtttttaaaggtggtttttgagt |
219 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432874 |
atatttcactaataccgtaaaaaaacttgatttagtattgattttataagtggaagtttatataggtatttagacttgtttttaaaggtggtttttgagt |
34432973 |
T |
|
| Q |
220 |
tagattcttctcact |
234 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34432974 |
tagattcttctcact |
34432988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University