View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16572_low_14 (Length: 362)
Name: NF16572_low_14
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16572_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 6e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 134 - 248
Target Start/End: Original strand, 3610432 - 3610546
Alignment:
| Q |
134 |
gaaaaataattcagatggacgattttagatcaaagttgactataaatcatcccaagagagaggaagagtgtttggttgtattattgtatatctaattatc |
233 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3610432 |
gaaaaataattcagatgaacgattttagatcaaagttgactataaatcatcccaagagagaggaagagtgtttggttgtattattgtatatctaattatc |
3610531 |
T |
|
| Q |
234 |
atttaactattctca |
248 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3610532 |
atttaactattctca |
3610546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 308 - 347
Target Start/End: Original strand, 3610606 - 3610645
Alignment:
| Q |
308 |
ataacaaaatcaaattttaatcaagattttcttatagaat |
347 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3610606 |
ataacaaaatcaaattttattcaagattttcttatagaat |
3610645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University