View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16572_low_17 (Length: 327)
Name: NF16572_low_17
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16572_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 5 - 312
Target Start/End: Complemental strand, 37161141 - 37160834
Alignment:
| Q |
5 |
gaggagcagagattgatttagaggtggaaaacggatacttacctatttgggtgatatcgactataatggattttgcttcaacaattggttttaacttgaa |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37161141 |
gaggagccaagattgatttagaggtggaaaacggatacttacctatttgggtgatatcgactataattgattttgcttcaacaattggttttaacttgaa |
37161042 |
T |
 |
| Q |
105 |
gctaaaatttatagtttttgacttcaagtttattgctcaatccactcttacagagatgtttccaaacataaaatcaattatacacaatctttgatgttca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37161041 |
gctaaaatttatagtttttgacttcaagtttattgctcaatccactcttacagagatgtttccaaacataaaatcaattatacacaatctttgatgttca |
37160942 |
T |
 |
| Q |
205 |
aaattaatttttgtagttgtggaatcaaacatatactaaaacttgatatcaatgtctgcaatgaagaaggtttgacttctattggtttccccctaaatgg |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37160941 |
aaattaatttttgtagttgtggaatcaaacatacactaaaacttgctatcaatgtctgcaatgaagaaggtttgacttctattggtttccccctaaatgg |
37160842 |
T |
 |
| Q |
305 |
aactttat |
312 |
Q |
| |
|
|||||||| |
|
|
| T |
37160841 |
aactttat |
37160834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University