View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16572_low_24 (Length: 263)
Name: NF16572_low_24
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16572_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 112 - 247
Target Start/End: Original strand, 13847704 - 13847839
Alignment:
| Q |
112 |
ttttgctgcatattgctatcatacacatggaaatgcataaaaggcatacttgatgatgaaagatacaatcatcataccttgatgcaagaagaaagaagag |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13847704 |
ttttgcagcatattgctatcatacacatggaaatgcataaaaggcatacttgatgatgaaagatacaatcatcataccttgatgcaagaagaaagaagag |
13847803 |
T |
 |
| Q |
212 |
gggacaaatcattcttcatattttctcgaaggattc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13847804 |
gggacaaatcattcttcatattttctcgaaggattc |
13847839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 108 - 247
Target Start/End: Original strand, 13839077 - 13839216
Alignment:
| Q |
108 |
aatattttgctgcatattgctatcatacacatggaaatgcataaaaggcatacttgatgatgaaagatacaatcatcataccttgatgcaagaagaaaga |
207 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
13839077 |
aatattttgccgcatattgctatcatacacatggaaatgcataaaaggcatacttgatgatgaaatatacaatcaccataccttgatgcaagaagaaaga |
13839176 |
T |
 |
| Q |
208 |
agaggggacaaatcattcttcatattttctcgaaggattc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13839177 |
agaggggacaaatcattcttcatattttctcgaaggattc |
13839216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 13847626 - 13847693
Alignment:
| Q |
1 |
agtaatgacactgacattgtcaacaagacacagatgcagaaaacatgttcaagcgccaagccaactac |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13847626 |
agtaatgacactgacattgtcaacaagacacagatgcagaaaacatgttcaagcaccaagccaactac |
13847693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 13838968 - 13839043
Alignment:
| Q |
1 |
agtaatgacactgacattgtcaacaagacacagatgcagaaaacatgttcaagcgccaagccaactacgggttcca |
76 |
Q |
| |
|
||||||| ||||||||||||||| |||||| |||||||||| |||| ||||||| |||||||||||||| ||||| |
|
|
| T |
13838968 |
agtaatggcactgacattgtcaagaagacatagatgcagaagacatattcaagcaacaagccaactacggtttcca |
13839043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University