View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16572_low_33 (Length: 239)
Name: NF16572_low_33
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16572_low_33 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 40898994 - 40898768
Alignment:
| Q |
18 |
tgaaacatacgcctcatcaaatgaaatgaatcataattgcttgcagaattaataagaatggttgtggctaagccctacgcatgttgatccataattgaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40898994 |
tgaaacatacgcctcatcaaatgaaatgaatcataattgcttgcagaattaataagaatggttgtggctaagccctactcatgttgatccataattgaat |
40898895 |
T |
|
| Q |
118 |
---attaagttcattttatgagcaaacaaataaaaataaaatcgtacatacctgttgatacgaatatgaaagccaa--taatgacatagacatacttcac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | | | ||||||||||||||||||||| |
|
|
| T |
40898894 |
attattaagttcattttatgagcaaacaaataaaaataaaatcatacatacctgttgatacgaatatgatatcatagccaatgacatagacatacttcac |
40898795 |
T |
|
| Q |
213 |
gaattcatcaaatccttcccggctcac |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40898794 |
gaattcatcaaatccttcccggctcac |
40898768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University