View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16573_high_26 (Length: 331)
Name: NF16573_high_26
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16573_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 2177426 - 2177229
Alignment:
| Q |
1 |
catagcaaagacatgtatgacttttctcttccttgacccctaggtcacttcattgatattgagcagnnnnnnnttcaggtaattagtccatgaccctttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2177426 |
catagcaaagacatgtatgacttttctcttccttgacccctaggtcacttcattgatattgagcagaaaaaaattcaggtaattagtccatgaccctttg |
2177327 |
T |
 |
| Q |
101 |
tgccccgccaccctagacatatcgatcatatgcttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccata |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177326 |
tgccccgccaccctagacatatcgatcatatgcttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccata |
2177229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 255 - 318
Target Start/End: Complemental strand, 2177173 - 2177110
Alignment:
| Q |
255 |
aaacataaaaccatgatcactaccatattgtttgattgtcttgaatttcttagtagaaaaatat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177173 |
aaacataaaaccatgatcactaccatattgtttgattgtcttgaatttcttagtagaaaaatat |
2177110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University