View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16573_high_33 (Length: 277)
Name: NF16573_high_33
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16573_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 260
Target Start/End: Complemental strand, 39014844 - 39014587
Alignment:
| Q |
9 |
gaagaatatagtctagaagatggtgtggcttcaaacttggacgcaataagatttgaggttgataatgataatgtggtcttactataaagatagataataa |
108 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014844 |
gaagaaaatagcctagaagatggtgtggcttcaaacttggacgcaataagatttgaggttgatgatgataatgtggtcttactataaagatagataataa |
39014745 |
T |
 |
| Q |
109 |
aacatgcattctacatgtacatatatattattat------aaggttctttgtgtcatatattctcaaatttgatttatttgtgaatgtattcattgtgtt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014744 |
aacatgcattctacatgtacatatatattattattattataaggttctttgtgtcatatattctcaaatttgatttatttgtgaatgtattcattgtgtt |
39014645 |
T |
 |
| Q |
203 |
tagcttttagtggcaaaggcacatgctagattgggatttggtgtttcaagattggggt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014644 |
tagcttttagtggcaaaggcacatgctagattgggatttggtgtttcaagattggggt |
39014587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University