View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16573_high_35 (Length: 270)
Name: NF16573_high_35
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16573_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 55286191 - 55285953
Alignment:
| Q |
16 |
gcagagatggcaagtagggtttttgtaagagttaaagagtgtgcatgatttgcaggaccattttggagaagacgaaga------agtagcagaagaagaa |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55286191 |
gcagagatggcaaatagggtttttgtaagagttaaagagtgtgcatgatttgcaggaccattttggagaagacgaagacgaagaagtagcagaagaagaa |
55286092 |
T |
 |
| Q |
110 |
gaggggtgtggaggggatgaaaaacagatttcgcattcagatatttgagaaggtggattgacgaaagtgcattttttgcatgaccaagacattggagatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55286091 |
gaggggtgtggaggggatgaaaaacagatttcgcattcagatatttgagaaggtggattgacgaaagtgcattttttgcatgaccaagacattggagatg |
55285992 |
T |
 |
| Q |
210 |
attgaatttgaagaaagtttgaattttgggaatggtggt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55285991 |
attgaatttgaagaaagtttgaattttgggaatggtggt |
55285953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University