View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16573_high_52 (Length: 213)
Name: NF16573_high_52
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16573_high_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 89 - 195
Target Start/End: Complemental strand, 3521284 - 3521178
Alignment:
| Q |
89 |
cacgtcatcacttcccaccaaaaattcatggggcggacccgaatgggaaaaacgggtcaccaaatcaacccgccataactctccctccggttcaccactc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521284 |
cacgtcatcacttcccaccaaaaattcatggggcggacccgaatgggaaaaacgggtcaccaaatcaacccgccataactctccctccggttcaccactc |
3521185 |
T |
|
| Q |
189 |
accgttc |
195 |
Q |
| |
|
||||||| |
|
|
| T |
3521184 |
accgttc |
3521178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 2 - 31
Target Start/End: Complemental strand, 3521371 - 3521342
Alignment:
| Q |
2 |
tcgcattagatcatcaaaattcacactatg |
31 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3521371 |
tcgcattagatcatcaaaattcacactatg |
3521342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University