View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16573_high_55 (Length: 201)
Name: NF16573_high_55
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16573_high_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 24098811 - 24098621
Alignment:
| Q |
1 |
taaccaaaattacgagtccatcacaaggtagaactagagaatcgatccgaagagnnnnnnnnattttatctagtttcaaggtgtttgctaaaaagaggat |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24098811 |
taaccaaaattaggagtccatcacaaggtagaagtagagaatcgacccgaagagttcttta-attttatctagtttcaaggtgtttgctaaaaagaggat |
24098713 |
T |
 |
| Q |
101 |
attaac-atcgttctttgctttcacattataagtcatttgaactttttcttttcttaaaatctcgaaggtttgcccgggaggtaagtataat |
191 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24098712 |
attaactatcggtctttgctttcacattataagtcatttgaactttttcttttcttaaaatatcgaaggtttgcccgggaggtaagtataat |
24098621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University