View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16573_low_23 (Length: 372)
Name: NF16573_low_23
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16573_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 105 - 355
Target Start/End: Original strand, 28423063 - 28423313
Alignment:
| Q |
105 |
acataattatattgaatcctgtcatctgtgtccggtgattaatctttttatttttgtagttttcaacacgaattcaaatcagagcgtgattctcacgtac |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28423063 |
acataattatattgaatcatgtcatctgtgtccggtgattaatctttttatttttgtagttttcaacacgaattcaaatcagagcgtgattctcacgtac |
28423162 |
T |
 |
| Q |
205 |
aacaaaaccgcatacacgagctgcaccgccgacgactccgacgttggaacattcatctacaacggtggaaccaataatttcagcgaaacattgactattc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28423163 |
aacaaaaccgcatacacgagctgcaccgcagacgactccgacgttggaacattcatctacaacggtggaaccaataatttcagcgaaacgttgactattc |
28423262 |
T |
 |
| Q |
305 |
ccgttccgttgactattgtgggactcaactacttcttctccgataccaatg |
355 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28423263 |
ccgttccgttgactattgtgggacccaactacttcttctccgataccaatg |
28423313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 28422920 - 28423007
Alignment:
| Q |
1 |
tactcttcttgggcttcctctcaatctttcaacctcggcgattatctcagtaagctcaatccctctctctagatctttaaattcatta |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28422920 |
tactcttcttgggcttcctctcaatctttcaacctcggcgattatctcagtaagctcaatccctctctctagatctttaaattcatta |
28423007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University