View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16573_low_39 (Length: 281)
Name: NF16573_low_39
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16573_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 22 - 270
Target Start/End: Original strand, 38447045 - 38447293
Alignment:
| Q |
22 |
cagttccaatcgcgtgaggaagattaccaacgtggagacacagagatacgtggataacaatgttgatcgcagaagagttactccggttcattcctcgagg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38447045 |
cagttccaatcgcgtgaggaagattaccaacgtggagacacagagatacgtggataacaatgttgatcgcagaagagttactccggttcattcttcgagg |
38447144 |
T |
 |
| Q |
122 |
agtgaaccgaaccggcaatcaccgaaccagtcgccgagaatgagaaaagttgccacttaccaaaaagagaaggcctcggtggaagatgaatcatcaagta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38447145 |
agtgaaccgaaccggcaatcaccgaaccagtcgccgagaatgagaaaagttgccacttaccaaaaagagaagtcctcggtggaagatgaatcatcaagta |
38447244 |
T |
 |
| Q |
222 |
cctcttcacataccgatactgaggtttgtatattttattaatttttcat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38447245 |
cctcttcacataccgatactgaggtttgtatattttattaatttttcat |
38447293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University