View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16573_low_48 (Length: 248)
Name: NF16573_low_48
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16573_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 20 - 234
Target Start/End: Original strand, 52272576 - 52272790
Alignment:
| Q |
20 |
taataaactaacacaaagatttcaagggcaaaaataaatcagttatatttgatatcttctatactttgtaacttatggatttcaaatttctcaatttata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52272576 |
taataaactaacacaaagatttcaagggcaaaaataaatcagttatatttgatatcttctatactttgtaacttatggatttcaaatttctcaatttata |
52272675 |
T |
 |
| Q |
120 |
gtttatttattatcacatttcttaatgccatcaaaatatactgagagcagatacaattatacaaatatcagttcagtccccagttagatgtccaaaatca |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52272676 |
gtttatttattatcacatttcttaataccatcaaaatatactgagagcagatacaattatacaaatatcagttcagtccccagttagatgtccaaaatca |
52272775 |
T |
 |
| Q |
220 |
atgcattagaataat |
234 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52272776 |
atgcattagaataat |
52272790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University