View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16573_low_50 (Length: 240)
Name: NF16573_low_50
Description: NF16573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16573_low_50 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 28341443 - 28341675
Alignment:
| Q |
20 |
cggagatggttgtcgaaaccaagattcaggaaattcagaaggtggaatctgcgacggatgaacaggaagcaaaagttgacggagaaaacggcgatgttga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28341443 |
cggagatggttgtcgaaaccaagattcaggaaattcagaaggtggaatctgtgatggatgaacaggaagtgaaagttgacggagaaaacggcgatgttga |
28341542 |
T |
 |
| Q |
120 |
agtttgccctgaagaaaacgctgagaaagtgatttcgttagttactgat------------gaacctgctgctgctgaggatccggttcaagaagcacct |
207 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
28341543 |
agtttaccccgaagaaaacgcagagaaagtgatttcgttagttactgatgaacctgctgaagaacctgctgctgctgaggatccggttccagaagctcct |
28341642 |
T |
 |
| Q |
208 |
cccggctcgttttgttcctgtggagttcaattt |
240 |
Q |
| |
|
|| || ||||||||||||||||||||||||||| |
|
|
| T |
28341643 |
cctggttcgttttgttcctgtggagttcaattt |
28341675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 114 - 202
Target Start/End: Complemental strand, 28382177 - 28382092
Alignment:
| Q |
114 |
tgttgaagtttgccctgaagaaaacgctgagaaagtgatttcgttagttactgatgaacctgctgctgctgaggatccggttcaagaag |
202 |
Q |
| |
|
|||||| |||| | ||||||||||||| || | ||||||| ||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
28382177 |
tgttgatgtttcctctgaagaaaacgcggaaagagtgattccgttagttactagtgaac---cttctgctgaggatccggttcaagaag |
28382092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University