View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16575_high_18 (Length: 342)
Name: NF16575_high_18
Description: NF16575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16575_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 18 - 334
Target Start/End: Original strand, 39021980 - 39022298
Alignment:
| Q |
18 |
tcgtccgtatcgtttcagccatgtttcatacctcttcttcatgactgcaggattagttgaattctttgtgtgtatttcaggacatgcacttgcagttatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39021980 |
tcgtccgtatcgtttcagccatgtttcatacctcttcttcatgactgcaggattagttgaattctttgtgtgtatttcaggacatgcacttgcaattatc |
39022079 |
T |
|
| Q |
118 |
catagattgagtataacaatgcttaatcttatagttgtcttcatggttagtcttagtgcatatggtgaattatagaattagcacaaaattgata--tatt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39022080 |
catagattgagtataacaatgcttaatgttatagttgtcttcatggttagtcttagtgcatatggtgaattatagaattagcacaaaattgatatttatt |
39022179 |
T |
|
| Q |
216 |
gattatcacgaacaacatatagttcttaatgtcttatttatttgtgcattgcaatgcatgctcgtttctgtttagatatacgtttcatttgcatatttat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39022180 |
gattatcacgaacaacatatagttcttaatgtcttatttatttgtgcattgcaatgcatgctcgtttctgtttagatacgtatttcatttgcatatttat |
39022279 |
T |
|
| Q |
316 |
caattgtattttcatgtct |
334 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39022280 |
caattgtattttcatgtct |
39022298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University