View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16575_low_10 (Length: 436)
Name: NF16575_low_10
Description: NF16575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16575_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 15 - 361
Target Start/End: Complemental strand, 40415138 - 40414793
Alignment:
| Q |
15 |
aaaaccaactcagatcactagcacaactccaatggcacgcgaagtggttgtcgaggtctgcgacatagtaacagagcgcggtgctcgcctagtcggagct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40415138 |
aaaaccaactcagatcactagcacaactccaatggcacgcgaagtggttgtcgaggtctgcaacatagtaacagagcgcggtgctcgcctagtcgg-gct |
40415040 |
T |
|
| Q |
115 |
ggaattgtatcaataatagaaaaagcgtagttacggttgaaggtggactttatgaacattataggattttcagaaattaccttcatagtagtgtatggga |
214 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40415039 |
ggaattgtatcaataatagaaaaagcatggttacggttgaaattgaactttatgaacattataggattttcagaaattaccttcatagtagtgtatggga |
40414940 |
T |
|
| Q |
215 |
aatgcttggcaatgatctttcggataatgtcattattgaacattctcatggtggctctggatctggtgctctatttcttgttgctgctgctgcttctcac |
314 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
40414939 |
aatgctcggcaatgatctttcggataatgtcattattgaacattctcatggtggctctggatctggtgctctatttcttgctgttgctgctgcttctcac |
40414840 |
T |
|
| Q |
315 |
attcccacacaacctgtagagtcttgaaaatctatgttttaagagtt |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40414839 |
attcccacacaacctgtagagtcttgaaaatctatgttttaaaagtt |
40414793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 397 - 429
Target Start/End: Complemental strand, 40414772 - 40414740
Alignment:
| Q |
397 |
agtttgatgtttgaacttgaaactataattcat |
429 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
40414772 |
agtttgatgtttgaatttgaaactataattcat |
40414740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University