View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16575_low_16 (Length: 369)
Name: NF16575_low_16
Description: NF16575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16575_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 26216323 - 26216518
Alignment:
| Q |
1 |
tcgagtgatcaataggtttagacaagcagtatcagattccaggttgttcgatttgcgcaaggaaggctattaatttacttggttccattttattggcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26216323 |
tcgagtgatcaataggtttagacaagcagtatcaaattccaggctgttcgatttgcgcatggaaggctattaatttacttggttccattttattggcaca |
26216422 |
T |
|
| Q |
101 |
gagcacacagtggaggtaaaacttgatagagcacgcaccgatggtgatttgtgtcatacatttcctaatgcacatctagaatgcttgacaactact |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26216423 |
gagcacacagtggaggtaaaactggatagagcacgcaccaatggtgatttgtgtcaaacatttcctaatgcacatctagaatgcttgacaactact |
26216518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 198 - 354
Target Start/End: Original strand, 26216551 - 26216707
Alignment:
| Q |
198 |
tgatccgatcaggacttctatgagttcaatgcggcggttcaagtttgaaaatgctttgttggaagaaccaggctttgaggattttgagtcaatgttggca |
297 |
Q |
| |
|
|||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26216551 |
tgatcccatcagtacttctatgagttcaacgcggcggttcaagtttgaaaatgctttgttggcagaaccaggctttgaggattttgagtcaatgttggca |
26216650 |
T |
|
| Q |
298 |
tatctaaaatggagttaatattgttgatcatcttggcatgtgtgcttctgatatgat |
354 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26216651 |
tatctcaaatggagttaatattgttgatcagcttggcatgtgtgcttctgatatgat |
26216707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University