View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16575_low_24 (Length: 298)
Name: NF16575_low_24
Description: NF16575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16575_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 19 - 149
Target Start/End: Complemental strand, 23335863 - 23335733
Alignment:
| Q |
19 |
ctcatactgaaatccattgcaaatggtgacacagaactgcttggggatgacaatgaggtgccgtcgtcgacgtcttctgtcgtcgccgccgggaaacggt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23335863 |
ctcatactgaaatccattgcaaatggtgacacagaactgctgggggatgacaatgaggtgccgtcgtcgacgtcttccgtcgtcgccgccgggaaacggt |
23335764 |
T |
|
| Q |
119 |
tcacgtctaactccctcaccggtccacctga |
149 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
23335763 |
tcacgtctagctccctcaccggtccacctga |
23335733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University