View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16575_low_26 (Length: 267)
Name: NF16575_low_26
Description: NF16575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16575_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 130 - 247
Target Start/End: Complemental strand, 29424981 - 29424864
Alignment:
| Q |
130 |
tttttaagaggcacgaaatttagaatttatgaccaataatctcatatttaacctttaatattataaaactctctttaagattcttctaataagattctaa |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29424981 |
tttttaagaggcacgaaatttaaaatttatgagcaataatctcatatttaacctttaatattataaaactctctttaagattcttctaataagattctaa |
29424882 |
T |
|
| Q |
230 |
ctaatttctgaatttcaa |
247 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29424881 |
ctaatttctgaatttcaa |
29424864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 29425551 - 29425462
Alignment:
| Q |
9 |
aaaatcaaaataaaatacataaataaattgagaacttttttatcctaccaaagtttgcatatacattttattttgttttagataaagtggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
29425551 |
aaaatcaaaataaaatacataaataaattgagaactttg--atcctaccaaagtttgcatatacattttattttgtcttagatgaagtggta |
29425462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University