View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16576_low_4 (Length: 291)
Name: NF16576_low_4
Description: NF16576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16576_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 1610138 - 1609862
Alignment:
| Q |
1 |
cacctgcattatggttatacactattctatttatgacttgtttagtcccatcatgcatttctttatcagttagttttacacgtgttagtagacaattttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1610138 |
cacctgcattatggttatacactattctatttatgacttgtttagtcccatcatgcatttctttattagttagttttacacgtgttagtagacaattttc |
1610039 |
T |
|
| Q |
101 |
ggccactttcactttccagacaaaatttctcacctttggctgcactgcaagtctccaaattaccatccaatcgccctccacctgcagttacgtattgtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1610038 |
ggccactttcactttccagacaaaatttctcacctttggctgcactgcaagtctccaaattaccatccaatcaccctccacctgcagttacgtattgtct |
1609939 |
T |
|
| Q |
201 |
gaaagttctgtctactaaccacaactatatgagaagaaaattacactaaattcagtatataatgtcccaccataact |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1609938 |
gaaagttctgtctactaaccacaactatatgagaagaaaattacactaaattcaatatataatgtcccaccataact |
1609862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University