View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16576_low_6 (Length: 240)
Name: NF16576_low_6
Description: NF16576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16576_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 13558026 - 13557803
Alignment:
| Q |
18 |
aaatcaggagccatggtttttgatcaagcagggatcagatcccataaaagagtatatgttggttaccattgctctatgctagctaaggatgaaagttttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13558026 |
aaatcaggagccatggtttttgatcaagcagggatcagatcccataaaagagtacatgttggttaccattgctctatgctagctaaggatgaaagttttg |
13557927 |
T |
|
| Q |
118 |
tgaatgctagtaataaatacagtaagtttttagatcaaaaagtaagtgatagaaacaagtaacaaaattcagaggtcttactaaagta-aatttggtgag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
13557926 |
tgaatgctagtaataaatacagtaagtttttagatcaaaaagtaagtgatagaaacaagtaacaaaattcagaggtcttactaaagtatattttggtgag |
13557827 |
T |
|
| Q |
217 |
cgctgctatacagcacgagggatt |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
13557826 |
cgctgctatacagcacgagggatt |
13557803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University