View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_high_14 (Length: 375)
Name: NF16577_high_14
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 235 - 360
Target Start/End: Complemental strand, 52443211 - 52443086
Alignment:
| Q |
235 |
attatgtgaaataacacttgagagttttattgttatattaaaaatgggagagataaattgacaaagcatcgtgctaaactcatgccatcgtttctttcat |
334 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52443211 |
attatgtgaaataatacttgagagctttattgttatattaaaaatgggagagataaattgacaaagcatcgtgctaaactcatgccatcgtttctttcat |
52443112 |
T |
|
| Q |
335 |
agtgcacatggtctgctatagacgtt |
360 |
Q |
| |
|
|||||||||| | ||||||||||||| |
|
|
| T |
52443111 |
agtgcacatgctatgctatagacgtt |
52443086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 86 - 155
Target Start/End: Complemental strand, 52443361 - 52443292
Alignment:
| Q |
86 |
atatcatgatccacctctccccttttaactttaaccgacatcttaaaccttctttcagtagactctaaaa |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52443361 |
atatcatgatccacctctccccttttaacttcaaccgacatcttaaaccttctttcagtagactctaaaa |
52443292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 52443413 - 52443383
Alignment:
| Q |
1 |
aaaatcgacatgttcatattgttcacatctt |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52443413 |
aaaatcgacatgttcatattgttcacatctt |
52443383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University