View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_high_25 (Length: 240)
Name: NF16577_high_25
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 45479915 - 45480121
Alignment:
| Q |
17 |
taggacaaatgttgaatgtatgcacgacaaacgcattggctagggtaatgataggacggcgagtatttaatgaggggaatggtgggtatgaatgtgatcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45479915 |
taggacaaatgttgaatgtatgcacgacaaacgcattggctagggtaatgataggacggcgagtatttaatgaggggaatggtgggtgtgaatgtgatcc |
45480014 |
T |
|
| Q |
117 |
tagggctgatgagtttaagtctatggtggttgaacttatggtattggctggtgttttcaatattggtgattttcttcctgctttcgagtggttggatctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45480015 |
tagggctgatgagtttaagtctatggttgttgaacttatggtattggctggtgttttcaatattggtgattttcttcctgctttcgagtggttggatctt |
45480114 |
T |
|
| Q |
217 |
caaggtg |
223 |
Q |
| |
|
||||||| |
|
|
| T |
45480115 |
caaggtg |
45480121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University