View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_high_28 (Length: 235)
Name: NF16577_high_28
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_high_28 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 235
Target Start/End: Complemental strand, 84559 - 84336
Alignment:
| Q |
12 |
atgaaggaggagatggagtgtcacagtagttatatccataccatgtgtcactagggatggacgagttgaaagtaaacgtaacagcatctgaattgtatcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
84559 |
atgaaggaggagatggagtgtcacagtagttatatccataccatgtgtcactagggatggacgagttgaaagtaaacgtaacagcatctgaattgtatcc |
84460 |
T |
 |
| Q |
112 |
gtagattttcacactttctggttcccaacccttgttatctgttgaacctgatctatatagataggcataacaaattgaagatgcacatggaccgtctatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||||| || |||| | |
|
|
| T |
84459 |
gtagattttcacactttctggttcccaacccttgttatccgttgaacctgatctatatagataggcaaaacaaattggagatgcacatggtccatctagt |
84360 |
T |
 |
| Q |
212 |
tgaaatgaatctgatgaacattgc |
235 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
84359 |
tgaaatgagtctgatgaacattgc |
84336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University