View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_high_31 (Length: 223)
Name: NF16577_high_31
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 15 - 204
Target Start/End: Original strand, 53474060 - 53474249
Alignment:
| Q |
15 |
caaaggtttgcaggaaaggagggaagatttggaaaggaaggacataaaagtaagcaacagaaaataaaggagtaaccacgtgtcgattaatagagcttta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53474060 |
caaaggtttgcaggaaaggagggaagatttggaaaggaaggacataaaagtaagcaacagaaaataaaggagtaaccacgtgtcgattaatagagcttta |
53474159 |
T |
 |
| Q |
115 |
ccgtatcaatgcaattaatcaataaataaattcaaaggtcttttatgaaagcacggaccttctttcaagaatcacaaccacacacgtggc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
53474160 |
ccgtatcaatgcaattaatcaataaataaattcaaaggtcttttatgaaagcacggaccttccttcaagaatcacaactacacacgtggc |
53474249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University