View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_high_35 (Length: 203)
Name: NF16577_high_35
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_high_35 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 40567582 - 40567380
Alignment:
| Q |
1 |
aatcctatatgataatgataataatattgacatgcatgagtttgacgtaactcccctactcatttttgtctctaataggcgcaagttatttgttttgnnn |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40567582 |
aatcccatatgataatgataataatattgacatgcatgagtttgacgtaactcccctactcatttttgtctctaataggcgcaagttatttgttttgttt |
40567483 |
T |
|
| Q |
101 |
nnnnggggtaaaataataagcggaagttaaagaatccaaagggctagtgatgcaatgcaaatcatggcttgtggtgccaccttcattcgcactcctcctc |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40567482 |
ttttggggtaaaataataggcggaagttaaagaatccaaagggctagtgatgcaatgcaaatcatggcttgtggtgccaccttcattcgcactccacctc |
40567383 |
T |
|
| Q |
201 |
tct |
203 |
Q |
| |
|
||| |
|
|
| T |
40567382 |
tct |
40567380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University