View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_low_14 (Length: 384)
Name: NF16577_low_14
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 72 - 358
Target Start/End: Original strand, 15302151 - 15302431
Alignment:
| Q |
72 |
ggagggctaggtgttagagttgttatcaatttgagtctcctagccagatagaggtggcggtacttcaaaaggatcattcactttggaaaagggttcttca |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15302151 |
ggagggctaggtgttagagttgttatcaatttgagtctcctaaccaaatagaggtggtggtacttcaaaaggatcattcactttggaaaagggttcttca |
15302250 |
T |
|
| Q |
172 |
tatgggctaatagaaagattgtgtgattgtgtacggatgggggtggggtgagtgagttcgatgaaagtgtttttgtttctc-tttggaagagtcaggcac |
270 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
15302251 |
tatgggctaatagaaa--------gattgtgtaaggatgggggtggggtgagtgagttcgatgagagtgtttttgtttctcttttggaagagtcaggcac |
15302342 |
T |
|
| Q |
271 |
cttcaaaggaggtagcannnnnnngggcccttttacttgattgtgttcctacacggtctaatcttgcgatt-gtcatgtactagaaccg |
358 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15302343 |
attcaaaggaggtagcattttcttgggcccttttacttgattgtgtttctacacggtctaatcttgcgattcgtcatgtactagaaccg |
15302431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 237 - 358
Target Start/End: Original strand, 15294705 - 15294827
Alignment:
| Q |
237 |
agtgtttttgtttctctttggaagagtcaggcaccttcaaaggaggtagcannnnnnngggcccttttacttgattgtgttcctacacggtctaatcttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15294705 |
agtgtttttgtttctctttggaagagtccggcacctccaaaggaggtagcattttcttgggcccttttaattgattgtgttcctacacggtctaatcttg |
15294804 |
T |
|
| Q |
337 |
cgatt-gtcatgtactagaaccg |
358 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
15294805 |
cgattcgtcatgtactagaaccg |
15294827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University