View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_low_24 (Length: 289)
Name: NF16577_low_24
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 32 - 272
Target Start/End: Complemental strand, 33655411 - 33655171
Alignment:
| Q |
32 |
atactactaaactaccaataaaaccctcttgcatcaatatcttgtacagttagctccagaagtttgttactcttattgattttgaaaattgcagattata |
131 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33655411 |
atactactaaattaccaataaaaccctcctgcatcaatatcttgtacagttagctccagaagtttgttactcttattgattttgaaaattgcagattata |
33655312 |
T |
|
| Q |
132 |
gcttgccagcatcagttcaaacaccatcatccgatggaagggctcaaatgccgaggtcatggccgaaccatcatccacactacattcacaattttcaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33655311 |
gcttgccagcatcagttcaaacaccatcatccgatggaagggctcaaatgctgaggtcatggccgaaccatcatccacagtacattcacaattttcaggg |
33655212 |
T |
|
| Q |
232 |
tcatggatttcaacaaacacctccataccaaggatacatgt |
272 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
33655211 |
tcatgcatttcaacaaacgcctccataccaaggatacatgt |
33655171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University