View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_low_28 (Length: 257)
Name: NF16577_low_28
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 9 - 109
Target Start/End: Original strand, 28667772 - 28667872
Alignment:
| Q |
9 |
atgaagagagtaattgcaatgagaatttctaggatttggatgtcttgtaagagggagagactaatggaatagatcatgttgaagttgaagtttgcggcgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28667772 |
atgaagagagtaattgcaatgagaatttctaggatttggatgtcttgtaagagggagagactaatggaatagatcatgttgaagttgaagtttgcggcgg |
28667871 |
T |
|
| Q |
109 |
c |
109 |
Q |
| |
|
| |
|
|
| T |
28667872 |
c |
28667872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 142 - 241
Target Start/End: Original strand, 28667917 - 28668016
Alignment:
| Q |
142 |
taaagttgatattggatgatttggtcatggtgtttgaaagataaggaatgtgaaaatgcatgtttaatcagtttgtaaggactaataaaaatggtgttgg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28667917 |
taaagttgatattggatgatttggtcatggtgtttgaaagataaggaatgtgaaaatgcatgtttaatcagtttgtaaggactaataataatggtgttgg |
28668016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University