View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_low_32 (Length: 237)
Name: NF16577_low_32
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 228
Target Start/End: Original strand, 7142276 - 7142490
Alignment:
| Q |
14 |
acaatgatcatgtcatggactttgcaattcatttgaacatgcaatctcacaaagtattatggattgatgctacatcaagaatttaaaaagggctcaatga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
7142276 |
acaatgatcatgtcatggactttgcaattcatttgaacatgcaatctcacaaagtattatggattgatgctacatcaagaatttaaaaagagctcaacga |
7142375 |
T |
|
| Q |
114 |
tcgatttaaaaagagctcaatgatcgattttattaaggagacatttttagaatctctaatgtttaagaagaaatctatactttctaaacaaggtgaatgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7142376 |
tcgatttaaaaagagctcaatgatcgattttatcaaggagacatttttagaatctctaacgttcaagaagaaatctatactttctaaacaaggtgaatgt |
7142475 |
T |
|
| Q |
214 |
tctatctcttcttat |
228 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
7142476 |
tctatcttttcttat |
7142490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University