View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16577_low_45 (Length: 202)
Name: NF16577_low_45
Description: NF16577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16577_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 14 - 189
Target Start/End: Original strand, 21056581 - 21056756
Alignment:
| Q |
14 |
aaatgaagatctcgaaggtgaatatgaatcatacaattttatacattatgcaacatgcacctgaattttatacagtatacatttcttgatatttaggcgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
21056581 |
aaatgaagatctcgaaggtgaatatgaatcatacaattttatacattatgcaacatgcacctgaattttatacagtatacatttcttgatatttaagcat |
21056680 |
T |
 |
| Q |
114 |
tgtttaatttacattaaatcgcttgagaaaaatgcttctcttgcacctgtattttgatttactcgacatcatttct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21056681 |
tgtttaatttacattaaatcgcttgagaaaaatgcttctcttgcacctgtattttgatttactcgacatcgtttct |
21056756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 91 - 189
Target Start/End: Complemental strand, 26365350 - 26365251
Alignment:
| Q |
91 |
tacatttcttgatatttaggcgttgtttaatttacattaaatcgcttgagaaaaatgcttctcttg--cacctgtattttgatttactcgacatcatttc |
188 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||| ||||| |||||||| |||||||| ||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
26365350 |
tacatttcttgatatttaggtgttgattaattcacattgaatcgtttgagaaacatgcttct-ttgcacacctgtattttgatttacttgacgtcatttc |
26365252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University