View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16578_high_33 (Length: 269)
Name: NF16578_high_33
Description: NF16578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16578_high_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 33704989 - 33704757
Alignment:
| Q |
18 |
cttcatacagattaatgaagcacttctgggatcttctcacctctaataaccaatggatcaaattattaaatgctagagttatgtgaactattgttcctat |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
33704989 |
cttcacacagattaatgaagcacttctgggatcttctcacctctaataaccaatggg-------atcaaatgctagagttatgtgaactattgttcctat |
33704897 |
T |
|
| Q |
118 |
attctatactatactgattcatctaactgaaagagtattaagtccatgtttagtgctatcctatcagtggcttcttggtaatggttttggcatgaaatta |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33704896 |
attctacactatactgattcatctaactgaaagagtattaagtccatgtttagtgctatcctatcagtggcttcttggtaatggttttggcatgaaatta |
33704797 |
T |
|
| Q |
218 |
ccttcactatcgcgtatgacacctccgcagccagcaattc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33704796 |
ccttcactatcgcgtatgacacctccgcagccagcaattc |
33704757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 210 - 254
Target Start/End: Complemental strand, 33715355 - 33715311
Alignment:
| Q |
210 |
tgaaattaccttcactatcgcgtatgacacctccgcagccagcaa |
254 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || |||||||||| |
|
|
| T |
33715355 |
tgaaattaccttcactaccgcgtatgacaccaccacagccagcaa |
33715311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 254
Target Start/End: Complemental strand, 21183442 - 21183398
Alignment:
| Q |
210 |
tgaaattaccttcactatcgcgtatgacacctccgcagccagcaa |
254 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||| |||||| |
|
|
| T |
21183442 |
tgaaattaccttcactatcacatatgacaccaccgcagtcagcaa |
21183398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University