View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16578_high_38 (Length: 238)
Name: NF16578_high_38
Description: NF16578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16578_high_38 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 55730124 - 55729898
Alignment:
| Q |
15 |
tcaaatctagtactcaagcattatgatnnnnnnncaagtgaacattttatatcaaataaaaacaattatattcattaccccacaaaaattaattgnnnnn |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55730124 |
tcaaatctagtactcaagcattatgataaaaaaacaagtgaacattttatatcaaataaaaacaattatatttattaccccacaaaaattaattgttttt |
55730025 |
T |
|
| Q |
115 |
nnn---agaggaacccacaaaacttcatgttcgccacaaagaaaatgcaatttgtatggtgctacttgcaacaataaaaataaggggatgatcaaattgc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55730024 |
tttttgagaggaacccacaaaacttcatgttcgccacaaagaaaatgcaatttgtatggtgctacttgcaacaataaaaataaggggatgatcaaattgc |
55729925 |
T |
|
| Q |
212 |
taccacgataaacaaaaattgaatttt |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
55729924 |
taccacgataaacaaaaattgaatttt |
55729898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University