View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16578_high_40 (Length: 236)
Name: NF16578_high_40
Description: NF16578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16578_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 70 - 223
Target Start/End: Original strand, 39487473 - 39487626
Alignment:
| Q |
70 |
aataatattgttccgtaacactgacatgcgtcgatgttttttccagtataacagttgatatttgaggcgagcgagtgcatggtctactatgtgctattat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39487473 |
aataatattgttccgtaacactgacatgcgttgatgttttttccagtataacagttgatatttgaggcgagcgagtgcatggtctactatgtgctattat |
39487572 |
T |
 |
| Q |
170 |
ttgctctctttggtgggagtttgagctatacaagtgtaatttccttgattaaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39487573 |
ttgctctctttggtgggagtttgagctatacaagtgtaatttccttgattaaat |
39487626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University