View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16578_high_5 (Length: 460)
Name: NF16578_high_5
Description: NF16578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16578_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 206 - 442
Target Start/End: Original strand, 33463117 - 33463353
Alignment:
| Q |
206 |
tcagctgatgagatccaacaatactatcaatgccaatgaaaacgacccatcacttacatcattaataaatagacaaggcttctcggaaaaccaagcaatg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33463117 |
tcagctgatgagatccaacaatactatcaatgccaatgaaaacgacccatcacttacaccattaataaatagacaaggcttctcggaaaaccaagcaatg |
33463216 |
T |
 |
| Q |
306 |
ttgttgcaacaaccatcttccaccgttaaaaccaccgtctctgaggtggcaccacctatctccgattcaatggctattgatgacacttgtcgacatggca |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33463217 |
ttgttgcaacaaccatcttccaccgttaaaaccaccgtctctgaggtggcaccacctatctccgattcaatggctattgatgacacttgtcgacatggca |
33463316 |
T |
 |
| Q |
406 |
gctttgtttcagcggaatatgggaccactactggtac |
442 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33463317 |
gctttgtttcagcggaatatgggaccactactggtac |
33463353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 13 - 61
Target Start/End: Original strand, 33462933 - 33462981
Alignment:
| Q |
13 |
cagaaggagatcaagaagatagagaaaacaagaatcctcaaagcagtac |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33462933 |
cagaaggagatcaagaagatagagaaaacaagaatcctcaaagcagtac |
33462981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University