View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16578_low_15 (Length: 361)
Name: NF16578_low_15
Description: NF16578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16578_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 18 - 313
Target Start/End: Complemental strand, 4084493 - 4084198
Alignment:
| Q |
18 |
aatgggtaatcaaaataatgaaaaagaaccttgttcattgcgagcggtgaaaatgatggtaccagtttcatcaccgatgagacattcagagataagagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4084493 |
aatgggtaatcaaaataatgaaaaagaaccttgttcattgcgagcggtgaaaatgatggtaccagtttcatcaccgatgagacactcagagataagagta |
4084394 |
T |
 |
| Q |
118 |
ggacgaacaataccacgagaagatgaagaaggtcttgttcctccacctttttgcagaacagtttcggaggttaaaaccttagcaatcaaagtgtgtccgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4084393 |
ggacgaacaataccacgagaagatgaagaaggtcttgttcctccacctttttgcagaacagtttcggaggttaaaaccttagcaatcaaagtgtgtccgt |
4084294 |
T |
 |
| Q |
218 |
ttgttccaggtttcatctgatccacttttgtgaaagtgggttttctctttgcgggtttggttccgtcttcttgtgaaacaacattcgatgatgcca |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4084293 |
ttgttccaggtttcatctgatccacttttgtgaaagtgggttttctctttgcgggtttggttccatcttcttgtgaaacaacattcgatgatgcca |
4084198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 106
Target Start/End: Complemental strand, 38787494 - 38787433
Alignment:
| Q |
45 |
accttgttcattgcgagcggtgaaaatgatggtaccagtttcatcaccgatgagacattcag |
106 |
Q |
| |
|
|||||||||||||||||| ||||| || ||| || ||||||||||||| || | |||||||| |
|
|
| T |
38787494 |
accttgttcattgcgagcagtgaagattatgctagcagtttcatcaccaattacacattcag |
38787433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University