View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16578_low_24 (Length: 332)
Name: NF16578_low_24
Description: NF16578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16578_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 17 - 228
Target Start/End: Complemental strand, 4865559 - 4865344
Alignment:
| Q |
17 |
aaaactgaatttgtgagaatgagaagatattattgattaagtgattctattacaagcagtagtttatatacaagttggaaatgaaagctcatcataacta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4865559 |
aaaactgaatttgtgagaatgagaagatattattgattaagtgattctattacaagcagtagtttatatacaagttggaaatgaaagctcatcataacta |
4865460 |
T |
 |
| Q |
117 |
acttgcttgtaacaaactaaaatgtaactgaaatgaaaatgaaatctttcctaattaagagataacttgc--------ctaactgtctttagtgatgtta |
208 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4865459 |
a----tttctaacaaactaaaatgtaactgaaatgaaaatgaaatctttcctaattaagagataacttgcgctccaagctaactgtctttagtgatgtta |
4865364 |
T |
 |
| Q |
209 |
tgtgccctctttctcatctg |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4865363 |
tgtgccctctttctcatctg |
4865344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 262 - 321
Target Start/End: Complemental strand, 4865344 - 4865285
Alignment:
| Q |
262 |
gctttcttaataaaaattacatactccaatgatgtatgggaaattttacccctctttcat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
4865344 |
gctttcttaataaaaattacatactccaatgatgtatgggaaattttacctctatttcat |
4865285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University