View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16578_low_29 (Length: 306)
Name: NF16578_low_29
Description: NF16578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16578_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 13 - 174
Target Start/End: Complemental strand, 37323118 - 37322957
Alignment:
| Q |
13 |
agatgaacatgatagtagtaaatggtgttaggcgtagcagagccagcttgcgtgagacagagtcattaatataggaagcaaatctgcagggagagagcgt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37323118 |
agataaacatgatagtagtaaatggtgttaggcgtagcagagccagcttgcgtgagacagagtcattaatatgggaagcaaatctgcagggagagagcgt |
37323019 |
T |
 |
| Q |
113 |
gtgatatgctttcaatttggaaagccccattgctttgcattttcttgagaaaaagagagaga |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37323018 |
gtgatatgctttcaatttggaaagccccattgctttgcattttcttgagaaagagagagaga |
37322957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 166 - 289
Target Start/End: Complemental strand, 37322923 - 37322808
Alignment:
| Q |
166 |
agagagagaaagaatgaatgtgaatcttataggagtaatcaatatgtgtggcccgatagctagggagaacttgtagtagtacactactaccattcatcta |
265 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37322923 |
agagagagagagaatgaatgtgaatcttataggagtaa-----atgtgtggcccgatagctagggagaacttgtagtagtaca---ctaccattcatcta |
37322832 |
T |
 |
| Q |
266 |
ctctaaatttttcacttacaaaat |
289 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37322831 |
ctctaaatttttcacttacaaaat |
37322808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University