View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16578_low_34 (Length: 279)
Name: NF16578_low_34
Description: NF16578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16578_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 132
Target Start/End: Complemental strand, 31420832 - 31420718
Alignment:
| Q |
18 |
ctttgaaatcaaaatattagacatatttaaggatggagtgaatcaattattagattacgaaagaaatgggaaaataaaattaattgtaaaaacataataa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31420832 |
ctttgaaatcaaaatattagacatatttaaggatggagtgaatcaattattagattgcgaaagaaatgggagaataaaattaattgtaaaaacataataa |
31420733 |
T |
|
| Q |
118 |
gaatacagtctaaat |
132 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31420732 |
gaatacagtctaaat |
31420718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 132 - 172
Target Start/End: Complemental strand, 31420699 - 31420659
Alignment:
| Q |
132 |
tctctggtgacgaattctgcaccccaaacatagccactatg |
172 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
31420699 |
tctctggtgacgaattctccaccccaagcatagccactatg |
31420659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University