View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16579_low_14 (Length: 212)
Name: NF16579_low_14
Description: NF16579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16579_low_14 |
 |  |
|
| [»] scaffold0094 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 17154448 - 17154641
Alignment:
| Q |
1 |
aagaaaagacttagacataatatatgaatagttttacctcatggaggtattggtgtcttacacacaccatcaatgcaaaacatatgtagaaaacttgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17154448 |
aagaaaagacttagacataatatatgaatagttttacctcatagaggtataggtgtcttacacacaccatcaatgcaaaacatatgtagaaaacttgctt |
17154547 |
T |
 |
| Q |
101 |
cgggatatattttataacaatcggcgtcagtgacacactcctctataatggaaaagaagaaaaaagaagtattagcaaaaaggggtgagagatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17154548 |
cgggatatattttataacaatcggcgtcagtgacacactcctctataatgtaaaagaagaaaaaagaagtattagcaaaaaggggtgagagatt |
17154641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 87 - 140
Target Start/End: Complemental strand, 16297 - 16244
Alignment:
| Q |
87 |
tagaaaacttgcttcgggatatattttataacaatcggcgtcagtgacacactc |
140 |
Q |
| |
|
|||||||||| || ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
16297 |
tagaaaactttgtttgggatattttttataacaatcagcgtcagtgacacactc |
16244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 42
Target Start/End: Complemental strand, 16381 - 16342
Alignment:
| Q |
3 |
gaaaagacttagacataatatatgaatagttttacctcat |
42 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
16381 |
gaaaagacttagagataatatataaatagttttacctcat |
16342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University