View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16579_low_6 (Length: 424)
Name: NF16579_low_6
Description: NF16579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16579_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 8e-71; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 151 - 294
Target Start/End: Original strand, 44034939 - 44035082
Alignment:
| Q |
151 |
attaccatattattaacgttgtttgtagttgaatctgagttagaaatgtttttagactcacccaagttcactcttttgttcttcctttgtctcttcacct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44034939 |
attaccatattattaacgttgtttgtagttgaatctgagttagaaatgtttttagactcacccaagttcactcttttgttcttcctttgtctcttcacct |
44035038 |
T |
|
| Q |
251 |
tccttggttacactattgtgttcttcgatacttggaaatgaaaa |
294 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
44035039 |
tccttggttacacgattgtgttcttcggtacttggaaatgaaaa |
44035082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 44034797 - 44034873
Alignment:
| Q |
9 |
atatgaaggatgtccatcaaattcatcgtctcatacgaagaatttacaacctgcactttttaaaaacatagacatca |
85 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44034797 |
atatgaaggatgtccatcaagttcatcgtctcatacgaagaatttacaacctgcactttttaaaaacatagacatca |
44034873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 360 - 408
Target Start/End: Original strand, 44035428 - 44035475
Alignment:
| Q |
360 |
tatataatactaaccttgatgttttaaatgttagggacaatagttgttt |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
44035428 |
tatataatactaaccttgatgttttaaatgtt-gagacaatagttgttt |
44035475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 358
Target Start/End: Original strand, 44035112 - 44035142
Alignment:
| Q |
328 |
tcactacaacaataccgatgcaactttttta |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44035112 |
tcactacaacaataccgatgcaactttttta |
44035142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 168 - 200
Target Start/End: Original strand, 37196523 - 37196555
Alignment:
| Q |
168 |
gttgtttgtagttgaatctgagttagaaatgtt |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
37196523 |
gttgtttgtggttgaatctgagttagaaatgtt |
37196555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University