View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16580_low_9 (Length: 233)
Name: NF16580_low_9
Description: NF16580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16580_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 26652378 - 26652579
Alignment:
| Q |
18 |
agaaagatggtctctgcagtggttttactgttgtgctttagtgattcggttgtcttggcaa-ttagttatgtgctgcgacttgtttttgatgattaactt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26652378 |
agaaagatggtctctgcagtggttttactgttgtgctttagtgattcggttgtcttggcaaattggttatgtgctgcgacttgtttttgatgattaactt |
26652477 |
T |
|
| Q |
117 |
atatggtttttcatctttaaacccaaaagaacaacgaagatagatagatttagagatgaagatgatgaatattatatttttacttttaatttagtcccta |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| || |
|
|
| T |
26652478 |
acatggtttttcatctttaaacccaaaagaacaacgaagatagatagatttagagatgaagatgatgaatattatttttttactttcaatttagtccgta |
26652577 |
T |
|
| Q |
217 |
tg |
218 |
Q |
| |
|
|| |
|
|
| T |
26652578 |
tg |
26652579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 147
Target Start/End: Original strand, 29980077 - 29980120
Alignment:
| Q |
104 |
tgatgattaacttatatggtttttcatctttaaacccaaaagaa |
147 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
29980077 |
tgatgattaacttatctagtttttcatctttaaacccaaaagaa |
29980120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 105 - 147
Target Start/End: Complemental strand, 43539392 - 43539350
Alignment:
| Q |
105 |
gatgattaacttatatggtttttcatctttaaacccaaaagaa |
147 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
43539392 |
gatgattaacttatctagtttttcatctttaaacccaaaagaa |
43539350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University