View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16583_high_17 (Length: 250)
Name: NF16583_high_17
Description: NF16583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16583_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 3524422 - 3524618
Alignment:
| Q |
11 |
ggtagataatactatgtttactcttcaaaagcaaccaaagatccgannnnnnnncaaacctaagacctcctctttagtaagaccctcttattcatat--t |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3524422 |
ggtacataatactatgtttactcttcaaaagcaaccaaagatccgattttttttcaaacctaagacctcctctttagtaagaccctcttattcatatatt |
3524521 |
T |
 |
| Q |
109 |
tgaagtctagagttgctatatacgtcaagcccattgattttctcctccaaatccccatacacttttcagttccacttcttgatttcaccctttatca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524522 |
tgaagtctagagttgctatatacgtcaagcccattgattttctcctccaaatccccatacacttttcagttccacttcttgatttcaccctttatca |
3524618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University