View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16583_high_19 (Length: 237)
Name: NF16583_high_19
Description: NF16583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16583_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 40744038 - 40744186
Alignment:
| Q |
1 |
atatcctataaaatatgggaatattggacaggtttctcgctattctttggattgatgattgataggcaacactactatattaaagagatcacttcattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40744038 |
atatcctataaaatatgggaatattggacaggtttctcgctattctttggattgatgattgataggcaacactactatattaaagagatcacttcattga |
40744137 |
T |
 |
| Q |
101 |
ggaagaatgtggaaaaatcaaagaaacaaatccacaatcacgaacctcc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40744138 |
ggaagaatgtggaaaaatcaaagaaacaaatccacaatcacgaacctcc |
40744186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 222
Target Start/End: Original strand, 40744226 - 40744259
Alignment:
| Q |
189 |
taattaaatggaatgaacaatatatgtgtatact |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40744226 |
taattaaatggaatgaacaatatatgtgtatact |
40744259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University