View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16583_low_17 (Length: 302)
Name: NF16583_low_17
Description: NF16583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16583_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 284
Target Start/End: Complemental strand, 11418305 - 11418028
Alignment:
| Q |
17 |
atatgtgatgaaatcaataatcttaggcctcacttcaacctcaacactgaggatacctttttcggccagataacatcaacggtgtttac----------t |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11418305 |
atatgtgatgaaatcaataatcttaggcctcacttcaacctcaacactgaggatacctttttcggccagataacatcaacggtgtttacactaccaaaat |
11418206 |
T |
 |
| Q |
107 |
tggtttttcttggctcttgaagaaacatggtcccgatgcaacacccttttcacgatcttggatttgacgccttcaacttatggaaaaaagtagatttcta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11418205 |
tggtttttcttggctcttgaagaaacatggtcccgatgcaacacccttttcacgatcttggatttgacgccttcaacttatggaaaaaagtagatttcta |
11418106 |
T |
 |
| Q |
207 |
gtatggatggcttgttatgattctatccctactacatctcttttgaatcatcagaaccaagcccctaatggcctctgt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11418105 |
gtatggatggcttgttatgattctatccctactacatctcttttgaatcatcagaaccaagcccctaatggcctctgt |
11418028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University