View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16583_low_23 (Length: 239)
Name: NF16583_low_23
Description: NF16583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16583_low_23 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 24182854 - 24182631
Alignment:
| Q |
18 |
aactgctccatttcaactcgaaggtgaatattgttcatgttgattttgatgtagtttttatttagggttttgaactattaagaaaggttaataggtgttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24182854 |
aactgctccatttcaactcgaaggtgaatattgttcatgttgattttgatgtagtttttatttagggttttgaactagtaagaaaggttaataggtgttt |
24182755 |
T |
 |
| Q |
118 |
tgtgaatgagaggtgcaatttcattgtagttttctgttgtc--ctttatatagaagtatttgtgaaattggaacaagggttcattttcatttccactttc |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24182754 |
tgggaatgagaggtgcaatttcattgtagttttctattgtcctctttatatagaagtatttgtgaaattggaacaagggttcattttcatttccactttc |
24182655 |
T |
 |
| Q |
216 |
tttctgcatataaatgtacttttt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24182654 |
tttctgcatataaatgtacttttt |
24182631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University