View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16583_low_24 (Length: 239)
Name: NF16583_low_24
Description: NF16583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16583_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 34096712 - 34096934
Alignment:
| Q |
19 |
gtcctccattctttttattaaggtgtcttaaagtcaccggtgagaattgaaaattttactattatcaaagaatttggtgaagacatttttagcttgtcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34096712 |
gtcctccattctttttattaaggtgtcttaaagtcaccggtgagaattgaaaattttactatcatcaaagaatttggtgaagacatttttagcttgtcca |
34096811 |
T |
 |
| Q |
119 |
atgagattggatgaaattgctagaattattattgctggtagtagcatcttgaggatttggaaataaacataataagttggaaccactgaga--gctaggt |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||| |
|
|
| T |
34096812 |
atgggattggatgaaattgctagaattattattgctggtagtagcatcttgaggatttggaaatgaacataataagttggaactactgagagcgctaggt |
34096911 |
T |
 |
| Q |
217 |
cacctcaaaatagttcccaagct |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34096912 |
cacctcaaaatagttcccaagct |
34096934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University