View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16583_low_29 (Length: 224)
Name: NF16583_low_29
Description: NF16583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16583_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 40 - 93
Target Start/End: Original strand, 24182868 - 24182921
Alignment:
| Q |
40 |
aaatcttgtgatgaagcctctacgaatttgaagacttccagaagaagattatgt |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24182868 |
aaatcttgtgatgaagcctctacgaatttgaagacttccagaagaagattatgt |
24182921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 150 - 204
Target Start/End: Original strand, 24182969 - 24183023
Alignment:
| Q |
150 |
gggatcagtgtccacgacactgaaactttacgatgatccttggaagatcaagaag |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24182969 |
gggatcagtgtccacgacattgaaactttacgatgatccttggaagatcaagaag |
24183023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University