View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16584_low_4 (Length: 307)
Name: NF16584_low_4
Description: NF16584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16584_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 20518738 - 20518881
Alignment:
| Q |
1 |
aggtccaaaaagggttaaagaaaggtc--atccacgtgaaatagtataatgaaaacgtgtgtaactaaacagtgacaactaataaacaattgcatgtacg |
98 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20518738 |
aggtccaaaaagggttaaagaaaggtctcatccacgtgaaatagtataatgaaaacgtgtgcaactaaacagtgacaactaataaacaattgcatgtacg |
20518837 |
T |
 |
| Q |
99 |
ttgcaaaacaagtgtcatcatagattcatacttgaataatcatg |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
20518838 |
ttgcaaaacaagtgtcatcatagattcatacttaaaaaatcatg |
20518881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 182 - 279
Target Start/End: Original strand, 20518922 - 20519015
Alignment:
| Q |
182 |
tttggtttcatccacctacaaatatttagattttagcagcagtaacaaacaaacaaacatagtactatgttatgttgtcggtgaaatattgaaaatgg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20518922 |
tttggtttcatccacctacaaatatttagattttagcagcag----caacaaacaaacatagtactatgttatgttgtcggtgaaatattgaaaatgg |
20519015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University