View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16585_high_17 (Length: 294)
Name: NF16585_high_17
Description: NF16585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16585_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 282
Target Start/End: Original strand, 5684556 - 5684819
Alignment:
| Q |
19 |
cctagaaataacaatcctcaacgacttctaaaagaactagcagaacgcnnnnnnntcactaacccaaaatcaaaatcaccaccaagacgttacattttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684556 |
cctagaaataacaatcctcaacgacttctaaaagaactagcagaacgcaaaaaaatcactaacccaaaatcaaaatcaccaccaagacgttacattttaa |
5684655 |
T |
 |
| Q |
119 |
aacccccactagacgataaaaaactcgcagaaagatttctcaacagtccacaactttcactaaaatcattcccattgttaagttcttgtctaccttcatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684656 |
aacccccactagacgataaaaaactcgcagaaagatttctcaacagtccacaactttcactaaaatcattcccattgttaagttcttgtctaccttcatt |
5684755 |
T |
 |
| Q |
219 |
gcgccttaacaatgccgataaattatggatcgatgagtatttactcgaagcgaaacaagccctt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684756 |
gcgccttaacaatgccgataaattatggatcgatgagtatttactcgaagcgaaacaagccctt |
5684819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University